posted 01-12-99 07:04 PM ET        

001/30/8
Brother Greg Treestock
Believer
New Jerusalem pharmaceutical laboratory

Brother Greg roused himself out of a reverie that had bordered on homesickness. He was fondly remembering his last XXXX drunk in The I Club back on Earth moon's Tyco Base. Those last weeks before the U.N.S. Unity slipped orbit and started on her way to Alpha Centauri were the next thing to a waking nightmare Greg could think of. That is, of course, if you didn't count the first few weeks on Planet. No one had adequately prepared for the affects the gravity would have on everyone. It also took a long time for the survivors to get used to the diurnal/nocturnal cycle. Most people had to live in their enviro-suits until the first pressure dome was erected and sealed. Then there were the damn mind worms. Absolutely no one had expected them. Worn out enviro-suits and mind worms had killed over 120 people at their base camp alone. Greg wondered how the other six factions had faired during those early days. No one seemed to want to talk about it yet over a year and a half after landing. Oh, well, that was then, this is now.

posted 01-12-99 07:48 PM ET            

Brother Legoean looked from the nope pad that he was wirteing the days orders on, "When will the your scout reports be back in Brother Haruhiro Honda? Our men will need time to advance on the new supply pod you found."

"Brother, You plan at take military action to retrive the supply pod," Brother Haruhiro responded with suprise.

Legoean taped the old pen one the side of the small card table that served as a desk. He looked at Haruhiro again and proceded, "The Gians have seen the worms infest a seed pod. We can't risk loseing civilans to the mind worms. So far our troops can do almost nothing agansed them. I was hopeing that with a little luck we could take the offencive on them."

"I see, but we have so little weapanry and Munitions."

Legoean looked at the roster of troops, only the Alpha Squad had weapons. 25 Volunters had arms, the other squads had to finish building the trenches along the front of the camp. "lets hope the pod has weapons or manufactoring capibilities, or soon we mad be over run with mind worms i fear."

"Sister Miriam, She will have a plan." Brother Haruhiro Honda said almost systematicly.

posted 01-13-99 03:01 PM ET            

Brother Greg, Sister Cecilia, and Brother Rahjiv were the Lord's Believers' ad hoc Planet Exploration Committee. They had called an emergency meeting in Sister Cecilia's lab at the request of Sister Sara.
"Well Brothers, what do you think this all about? Sister Sara isn't one to drag us into a meeting without good reason. She has too much field work under her belt for that." Began Sister Cecilia.
"All I know is that she and her team were doing some magnetometer readings around some of the drilling sites from the Peacekeeper's Narmonov Expedition. Added Brother Rahjiv not too helpfully.
"Sister Sara reminds me of a lab assistant I once knew." Mused Brother Greg.
"You're always saying that Brother Greg." Observed Sister Cecilia.

Sister Sara entered the lab with a strangely abstract look on her face, a sheaf of charts and a comlink 3-D projector.
"Sister, Brothers, I am sorry I am late but Sister Miriam demanded an interview as soon as I landed. She must have one o her staff monitoring all of the outside communications links." The second statement was said more to her self than the committee as she set up the display.

"What is all this Sister? What did you do, find a gold mine or something?" Asked Sister Cecilia.
"I would definitely put this in the "or something" category" Said Sister Sara as she dramatically activated her display. There was a long unblinking silence as a three dimensional image rotated in front of the four scientists.

At last Brother Rahjiv breathed, "That sure isn't a mineral formation."
"Holy Bleep." Muttered Brother Greg.
"Is that what I think it is? Did you put an X-File on that?" Whispered Sister Cecilia.
"Well, to answer questions in order: No it isn't: I agree: Yes it is an alien object and yes I did." Replied Sara in her familiar lecturer's voice.
"The black structure you see is 10 meters high but only two meters of it shows above ground surface. That is probably why the Narmonov Expedition missed it. I speculate that a fungus bloom obscured it when they were in the area. What you see in this image is it's full extent underground. Most of it is buried which suggests it has been here a long time. Our sub-surface imaging equipment indicates that it is attached to the underlying bedrock. It is 3 meters on a side at its base and tapers to the flat slab you see at its top."
"What is it made of?" Interjected Sister Cecilia.
"Now that's a very good question. As you can see, at a distance of ten meters the structure looks perfectly black, opaque and smooth. However, at close inspection it actually is partially translucent and the surface is covered with indentations and crenellated markings. We made some preliminary attempts to see how hard it is, something on the order of 8.5 on Moh's scale."
"Are you saying that there is some kind of writing on it." Asked Brother Greg.
"You people aren't as dumb as everyone says." Joked Sister Sara, "But that is another excellent observation. The short answer is, `I don't know yet.' As you will observe from this detail of the surface that it could be writing, it could be integrated circuitry, it is probably something else entirely."
"Well, tell us, Sister Sara, what is it." Murmured Brother Rahjiv, not sure he really wanted to know.
"You got me. I've never seen anything like it before in my life.* From my experience it reminds me of a cross between and Egyptian Obelisk and a Classic Maya stela. All I know for sure is that it wasn't made by humans, its been here a long time, and its harder than hell. I also recommended to Sister Miriam that we proceed with a detailed investigation of it. What ever `it" is."
"I think you can count on the backing of this Committee to do just that." Offered Brother Greg. "I could use a drink. Sister Cecilia, do you have anything in your bodega that could commemorate this occasion?"
"I have been saving my personal favorite concoction, a 24 year old single barrel bourbon that is so smooth it will bring a tear to your eyes, Brothers and Sister." Warned Sister Cecilia.

* This is a technical phrase used by every archaeologist I have known.

posted 01-13-99 05:39 PM ET            

Brother Legoean McKibben glanced at his Breach Loader, Thinking/hopeing that this would have some weapons or munitions that the spartans over looked. Also thinking/praying that there was not a mind worm infestation, there was fungi about 10km away, and Legoean knew that fungi and worms we close togher in ecology.

"Brothers and sisters, Surround the Pod with weapons drawen," Brother Legoean Catously said. He walked up to the pod and peered at it with mistery. What secrets would it hold? What would happen to his fellow brothers and sisters if battle ensued? these were questions the kept entering his mind.

"Brother shall I open it?" came a voice from the Alpha Squadren.

"no I shall do this one, brother. Brother Haruhiro will you step back a bit and give the order to fire if nessesary." legoean said as he turned looking the transparnt part of his enviro-suit ht the pod. "don't spare my life if mind worms attack our fellow brethen."

"Yes... I will." Haruhiro also loooked at the pod as he spoke.

"Here I go, wait for your orders before you do anything Alpha and Baker Squads, no one come in for me..." His words went into silence. He steped forward as he place his hand on the opening hatch. Slowly he opened the hatch.

After Peering inside, There was a minute of silance. Legoean then turned his head to the milita and said joyfully, "our prayers have been answered!"

An old fasioned Rebel Yell came from the few men in the milita the came from southern USA. Other's cheered, wile hugging one another.

"We have in here lots of munitions, a rover, rations, and science equipment. get a truck out here on the double." legoean said with great entusiasum. "Sister Miriam will be quite pleased with our efforts."

A pray came out, "Prase the lord."

posted 01-13-99 05:46 PM ET            

Sub-Lieutenant Mario Romano of the Black Watch was worried. Watch command had lost contact with its small garrison in the just-founded agricultural village of Demeter's Plantation three days ago. His militia-scout team had been immediately dispatched from Poseidon, reportedly by Commissioner Lal himself. He had a lot riding on this professionally, but his thoughts were firmly dwelling on personal matters. His fianc�e -- Kiara -- was stationed there.

His team's rover rolled along the coastal road. The waves of the Central Sea pounded the rocky shore. Demeter's Plantation lay just beyond the next bend:

There! In the distance, he saw the tiny dome of the village. He squinted to try to make out details better, completely forgetting about the 'scope to his right. Sergeant Chabrier saw it first on her sensor console: "Sir," she said, so tonelessly, "The dome is cracked."

Romano tried to remain calm. He failed. His heart raced. Kiara! Are you all right? Kiara?

They reached the dome. In deathly silence, they donned their enviros and exited the rover. The airlock to dome was breached, and a strange, fungus-like growth covered the dome's foundation. It was worse inside.

A few fisher misties floated around the top of the dome. That fungus covered about forty percent of the immediately viewable area. And the mindworms. There were only a few, mostly just hatched. They had reports from the Believers that larva were left behind in mindworm victims � Kiara!

James was the first to find a victim. "Over here" hissed the comm. Black male, tall. They sent a description to Chabrier back in the rover. "Lt. Williams, from the dossiers," the sergeant responded. The garrison's commander�

They continued to search. Within twenty minutes they had killed fifty-seven immature mindworms, covered half the dome, and found twenty-three of the forty-two stationed at Demeter. All dead.

Romano and Corporal Hill approached the village's physical plant. This is where Kiara would have been, would have been. She was a life-support specialist, an atmospherist. This is where she would have been.

Mario saw her first. Dead, like all to the others. While her body was nearly fully consumed by the surrounding fungus, her face was cruelly left untouched by the ravages of the mindworms, contorted into visage of torment incarnate. He stared into her eyes as his heart died.

Two hours later, they had searched the entire complex except for the clinic. Since they had found everyone who had lived here, all dead, they almost did not search it. But regulations insisted that the search be thorough, and Romano was a regulations man. He entered first, hacking through the fungus. Empty. He entered the pharmacy. Empty. He entered the records office. Empty.

And then he heard it. A faint cry. "Hill, Osaku. Did you hear that?"

"Hear what?" came the reply. He looked anyway. In the ward, he found the source: an infant, certainly no older than a few decurns, kept alive by the natal care unit. "I found someone. Alive."

The gasps of disbelief crackled over the comm. Osaku, their medic, came running. "Where?"

"There." He pointed.

Later that night, they discovered her identity by searching through the village's databank. She was seventeen days old, last name Wilder. Her parents, an engineer and a botanist, had never had a chance to name her. Hill was pondering what she should be named. Alice, Demeter, Zaria, Ceres, Marina � the suggestions piled up.

The name sprung to Mario's mind.

"She was a lucky discovery, totally unexpected, right?"

"Yeah. And?"

posted 01-14-99 04:07 PM ET            

Brother Rahjiv was looking over the sheaf of new communications that had just been forwarded to him. Brother Legoean had secured an intact supply pod, lost it, and then recovered it again. That was the kind of assistance from god they had been praying for, not some unknown, and maybe unknowable, obelisk from who knew where or when. "Tell Brother Legoean to send me an inventory of the pod's contents. Make sure that he dismantles the pod and recovers it as well." He spoke into his comlink and forwarded it to the "radio shack" for coded transmission.

The other news was very sad and more than a little troubling. The Peacekeepers were reporting that they had lost an entire domed village and suffered heavy casualties. There was no explanation on what had happened, but it looked like mind worms were somehow involved. If they had attacked a domed structure then it could mean a dangerous addition to their already aggressive behavior. Brother Rahjiv noticed, with approval, that Sister Miriam was sending delegations bearing black mourning wreaths to the Peacekeepers Headquarters in Hope as well as to their Consulate here in New Jerusalem.

posted 01-14-99 04:25 PM ET            

Brother Legoean looked over at the new communication He recived rom the radio Shack.
It appered to be from Brother Rahjiv Singh he looked at the contece of the one lined Com. and then Replyed back to it with a compleate list of the seed pod inventory.

Start Communication

The Inv. was
1. 2 Rovers/Prime Condition
2. 300 Ration packs/Healthy
3. 40 Shreeder Pistol Rechargers
4. 1 Gieger Counter
5. 1 Rather large electromagnet
6. 2 Large screen microscopes
7. 10 Field medical kits
8. 10 Enviro-suits/Prime condition
9. 16 Shreeder Pistols/Apears tampered with
10. 3 tons of scrap from Seed pod

posted 01-15-99 07:56 PM ET            

Brother Johnny was finally starting to feel like himself after the incident with the laboratory mind worm. Through his E-suit he unconsciously rubbed the blue sunburst tattoo-like scar on his forearm where he had received the sting. Most of the effects of the toxins had worn off and he knew he was very lucky to be alive. However, Johnny had the feeling that he was always being watched. It was an augmentation of the sensations that first tickled his senses as the U.N.S. Unity has closed in on Planet. But at the time he was trying to deal with the fresh, painful knowledge that his family had died in Cryobay #7 and he had thought at the time that it was a psychosomatic reaction to the stress and grief.

The grief and stress were still with him, and so was this weird feeling. "I must be going nuts." He said out loud. "Maybe Sister Miriam will pray with me, help to heal me."

posted 01-17-99 07:33 PM ET            

001/30.1
<four days prior to the post immediately above>

It was the first time they had ever done this. The entire upper government of the Peacekeepers had gathered in a single place: the cabinet, the council, the supreme court, and more. Fifty-seven persons all told. The Council's Chamber wasn't large enough for the task, nor was the Cabinet's. Instead they were meeting in the library of the Garland Musuem.

"Order, order. The first emergency general meeting of the Peacekeeper Government will come to order." Lal had learned a lot of parlaimentary jargon in his time in office [and had made up a lot of new terms also]. Lal glanced around the room. Borodino and Eck, both standing in the far corner, ceased their conversation. Kildare sat next to Takahashi on a divan. [They had no conversation to cease]. Vanerian and Ben Obed turned away from their game of chess. The murmuring around the library came to a halt.

"By now, you all know why are here. Four days ago, we lost contact with the small outpost of Demeter's Plantation. A Watch squad was immediately dispatched to investigate. They found the village's dome cracked and its inhabitants slaughtered. Apparently native organisms were responsible for this incident."

Lal was right: they all knew. This made the news, now official, no easier to bear. Councilor Janice Smith began to cry again -- her son had been stationed there. Lal called Commander Anderson to speak.

"Sub-lieutentant Mario Romano �."

Two hours later, Kevin Roberts, Lal's chief of staff, was finishing up. "� so the funeral will be held at here, in the Garland Musuem, as soon as the bodies are recovered. Most probably four days from now. Any questions?" None were asked.

Lal rose to speak again. "We will then end this meeting by remembering all forty-two friends, relatives, and colleagues we have lost." He began to read, pausing after each name. "Abdul Al-Nessim, Corey Andrews, Kimberly Andrews, Nadia Andropov, James Chaffin, Karl Czolgosz, Indira Daneshevar, Francesca DiPonio, Abigail Fielding, Andrea Fletcher, Mark Fletcher, Vanessa Gabor, Antonin Gottwald, Hong Li-Po, Phillip Hudson, Anne Kennedy, Kiara Korutsu, Kurt Lorraine, Maria Madesclaire, Ana Martinez, Lupe Menem, Simon Menem, Belle Messier, Susanne Niedermair, Kate O'Duggan, Ramon Ortega, Ano Paasikivi, Jean-Paul Pourier, Nikki Redford, Akira Rokin, Piero della Rovere, Frank Smith, Jason Thompson, N'du Tyson, Joachim VanderLeve, Leonid Verensky, Henry Wilder, Sara Wilder, J'mel Williams, Xia Milan, Emily Zhou."

posted 01-18-99 10:10 PM ET            

001/31.3

<This one is right>

"What is that?" St. John pointed out into the distance.

Rajiv picked up a 'scope. "It's � garbage?"

Ryan picked his 'scope up too. He saw several misties floating over the heap, not unlike the gulls of Earth. "We're the first ones ever here. How did this get here?"

They called up the rest of the expedition, about a quarter click behind. Commander Narmonov told them that the course had been adjusted.

posted 01-19-99 03:52 AM ET            

001/30.3

Report for 001/30.6

The package has been introduced into the dome agriculture area. It is expected that it will reach critical size in 2 to 3 days. Phase 1 of mission is a success.

An observer will remain behind to evaluate the success of our ploy.

End report.

Corp. Kyuden slowly relaxed. The package had been placed and now he was on his way home. It would be good to get back home, the foundary should be finished by now and he would be finally able to get some plating for the rover. Also it would be good to get some leave, after 30 days on extended patrol and black ops he was begining to feel a little tired, what the Earthers called it, battle fatigue.

Still, with this mission completed perhaps he would get another promotion, Sergeant Kyuden, it had a nice ring to it. Still that would have to wait until he returned to Sparta.

001/31.5

Sergeant Kyuden, Colonel Santiago, #Operative 013#.

"Sergeant, I was impressed with the result of your latest mission. It's good to see such an able soldier rising through the ranks" spoke Santiago, her voice monotone, giving nothing away.

"Sir, thank you sir."

"I have another missiom for you", she said "It will require the use of abilities that you have already amply demonstrated. I trust you will fulfil this mission perfectly."

"Sir, yes sir."

"Good,you will be briefed by operative 013 on the target," she turned to a wall mounted communicator,"enter"

A panel slowly slid open from behind Serg. Kyuden. With reflexes honed by experience he wirled on the spot, his hands automatically moving into a defensive posture to face the new arrival.

A small, bald man looked up at the Sergeant, "Ah, I am operative 013 SI, you are Sergeant Daniel Kyuden?"

His arms snapping to his sides he assumed a position of attention more suited to a parade,"Sir, yes sir."

"Good, good,"the small man stated,"let us begin with the briefing. Your target is Ben Oben, he is a Peacekeeper Minister. We need him removed, quietly."

posted 01-19-99 03:34 PM ET            

A procession of the entire executive staff of the Lord's Believers consulate at Hope slowly walked into the Peacekeepers Council's Camber to present a mourning wreath to Commissioner Pravin Lal. For this somber occasion the Believers had discarded their usual eclectic assortment of jump suits to don uniform black robes and cowls. Brother Eru lay the large bouquet of black ribbons on the table before Commissioner Lal.

"Dear Brother Lal, please accept this symbol of the Lord's Believers sincere sadness at this tragedy at Demeter's Plantation. Heaven knows that there are already too few of us here. Everyone is cherished and evryone will be missed. May god bless their souls" Atoned Brother Eur.
"Thou art god. God is Great." Chanted the rest of the delegation.

Commissioner Lal, already shaken from the loss of so many under his charge, was misty-eyed and speechless at the moving demonstration from the Believers. The entire Peacekeeper audience in the Chamber choked back sobs as the Believer delegation bowed low as one, turned and slowly left the building.

posted 01-19-99 03:46 PM ET            

Brother Legoean look nevous as he saw Glory I speed off back to New Jerusalam. He remembered when he was chased by mind worms comeing from this site. Legoean turned he head back to the small out post that had been constucted in a matter of days, Due to recent uproar of Native life. He gazed open the small baracks for the alpha squadren. And the wall of stone and Ground that had been placed around the site.

Even with all the new Equipment his men found he was still depresed. Comander Rajiv was to come and inspect the Alpha Centurians today. Also to over look the final constuction of the so called "Experimentation" outpost. Legoean thought that the obelisk might findout by other fractions. In his own opinion The University will probibly raid and cart it off the some lab to Probe it and all the things they do to things they haven't seen before. Legoean wanted the alpha Squadren to continue looking for more seed pods befor the other factions did.

There was a movement along hill west of the outpost. He picked up the scope and took a closer look. Are thoughs rovers he tought. there were only five of them but they apeared some what better armed. They were closeing in on the out post. Legoean didn't know wether to call his men to the battle stations, or to see what they wanted.

He ran over the the small radio that had been put there and put the dish toward the Rovers. He set it the sgnal on all band withs. "Rovers Who are aporching the base please respond on channel 136. Repeate. rovers Who are aporching the base please respond on channel 136."

He waited for 30 seconds then Repeated the same messege. Thinking that they wouldn't respond he ordered his men the a Yellow battle Alert.

There was A crakel on the radio then a messege came through, "These are the rovers," there was a small pause, "you are ordered To surrender the outpost."

Legoean ran back over to the radio and quicly Spoke. "One who's Orders??."

Again The same message came through. "you are ordered To surrender the outpost. Will you Comply?"

Again Legoean spoke as if to counter act there words. "Who are you?" then there was silence again. Legoean turned the dish back toward New Jerusalam and spook in to the trancever. "This is hand of god, We have got at Really big problem!"

Then Brother Legoean rased his Sharps rifle and said "Move your Battle stations NOW, squad". Legoean realized it was going to be a long day.

posted 01-19-99 08:01 PM ET            

Brother Rahjiv looked around with satisfaction with what had been accomplished in the few days since the Gloria I rover patrol had retreated in the face of massed mind worms. First, a 1 square kilometer area around the alien obelisk has been spayed with a new anti-fungal compound that Sister Cecilia and Brother Greg had developed. That had worked like a charm, destroying the xenofungus and causing the mind worms to retreat from the area. Brother Rahjiv did not want to think about the long-term toxic effects that spray would have, but he had to protect the archaeology crew and the militia from hypnotic affects and venom of the worms.

The next phase of the operation had been to air lift a squad of militia in to secure the area for the engineering team to be brought in. When the engineers arrived they quickly set up a few collapsible emergency domes and started camouflaging the obelisk, domes and the ground to make it look like a xenofungus bloom had just occurred while the militia set up a patrol and started to excavate O.P.s and spider holes. It was hoped that these actions would keep prying eyes at a distance confused about the nature of the site.

Brother Rahjiv saw the helicopter before he heard it. It was bringing in Sister Sara Croft and her team as well as a relief squad of militia. It would then take the engineers and current militia guards back to New Jerusalem. The `copter landed and the militia immediately deployed to secure the L.Z. before letting the "civilians" disembark. The engineers quickly hopped on the `copter as the Alpha squad replaced the Deltas in their parameter posts.

"Brother Logoean, I now turn this base over to you. I don't think the mind worms will bother you for a while, but something just doesn't feel right around here yet. Be careful, Brother. We don't want a "Demeter's Plantation" on our hands." Said Rahjiv to the young squad leader.
Brother Logoean fingered his antique rifle as his eyes evaluated the rolling landscape and the defensive positions. "Don't worry Brother Rahjiv. I won't let an Alamo happen here." Was his not too reassuring reply. Brother looked back at the nearly invisible camp sure that everything possible had been done in the short period provided. He then turned to Sister Sara.

"Sister Sara, I know you cannot wait to get your hands on that �.Thing� but are you sure this is a good idea. It could be dangerous, it could be evil."
"Don't worry about us, Brother. We're just going to dig some holes in the ground to see if we can figure out how that thing got here and how old it is. I'm going to leave any decision on what to do with it next up to Sister Miriam. This is too big for me." Stated Sister Sara. Brother Rahjiv looked at them both very hard for a minute. "Thou art god." He said as he turned and walked to the `copter which immediately took off.
"Thou art god." They said toward the fleeting aircraft.

posted 01-19-99 11:11 PM ET            

The main ballroom of the Garland Musuem had been suitably altered to fit the doleful occasion it hosted today. The nearly entire population of Hope was there [including the Beleiver consulate staff], as was a great number of the outposts' personnel. Somber attire had been donned by all and nary an eye was dry. The loss had been crushing. One in twenty-five dead!

Mournful music filled the room. The upper echelon entered in a processional. The six speakers for the ceremony filed up the dias: Commissioner Lal, Councilor Eck, Councilor FitzWilliams, Councilor Takahashi, Minister Borodino, and Commander Anderson.

The speeches were sombre and melancholy. The sense of the missing was overpowering. Lal lamented the loss of irreplacable lives. Eck philosphized on the spiritual element. FitzWilliams' speech was simple and rustic, but moving and emotional. Takahashi mourned the deaths with eloquent rhetoric. Borodino spoke only briefly, contemplating the hereafter and acknowleding the support of the Beleivers. Anderson plodded through his speech with slow grace.

Each of the fourty-two victims were eulogized in turn, from Al-Nessim to Zhou. Four percent! One in twenty-five! How to deal with the loss?

posted 01-19-99 11:12 PM ET            

"Greetings, Sister Ursula Hesse" Joupperi said.

"Peace in the name of the Lord, Warrant Officer Toivo Juopperi." Sister Ursala returned.

"We of the Peacekeepers welcome you to our consulate."

"And we of Believers thank you for your invitation."

They smiled at each, then they broke out in laughter. They both found the diplomatese required for a routine electro-magenetic emmissions check [EMEC] exceptionally humourous. "Ok, Ursula, now that our 'formal duties' are out of the way, why don't we get down to business."

The consulate staff save Sgt. Kaldhoun had cleared out. Sister Ursula and Brother Park entered the consulate. The routine EMEC regulations set up for both consulates allowed both factions to ensure that illegal EM recording and transmitting devices were not in operation. Toivo pulled out his Jeffers sensor. Sister Ursula had hers out already. They began in the kitchen. [They were hungry.]

"Apple?" Toivo asked.

"Sure" she answered, but Park declined. He began running his counter over the table. <beep> <beep> <beep> No unexpected flucuations.

"How's life?"

"The Lord blesses, as always. And you?"

"No complaints."

"Looks like the kitchen's clean."

"Jacobus will be pleased. The men's dorms next?"

"Why not?"

posted 01-19-99 11:12 PM ET            

"Greetings, Sister Ursula Hesse" Joupperi said.

"Peace in the name of the Lord, Warrant Officer Toivo Juopperi." Sister Ursala returned.

"We of the Peacekeepers welcome you to our consulate."

"And we of Believers thank you for your invitation."

They smiled at each, then they broke out in laughter. They both found the diplomatese required for a routine electro-magenetic emmissions check [EMEC] exceptionally humourous. "Ok, Ursula, now that our 'formal duties' are out of the way, why don't we get down to business."

The consulate staff save Sgt. Kaldhoun had cleared out. Sister Ursula and Brother Park entered the consulate. The routine EMEC regulations set up for both consulates allowed both factions to ensure that illegal EM recording and transmitting devices were not in operation. Toivo pulled out his Jeffers sensor. Sister Ursula had hers out already. They began in the kitchen. [They were hungry.]

"Apple?" Toivo asked.

"Sure" she answered, but Park declined. He began running his counter over the table. <beep> <beep> <beep> No unexpected flucuations.

"How's life?"

"The Lord blesses, as always. And you?"

"No complaints."

"Looks like the kitchen's clean."

"Jacobus will be pleased. The men's dorms next?"

"Why not?"

posted 01-20-99 06:25 AM ET            

"Crack," Legoean's carbin fired at round at the new 10 rovers that surounded them. "Give them what they wanted."

He said this as 3 of the overs came in for another frontal charge. Alpha squad opened up on the rovers and a pulm of dust spyed into the rovers eye. The rovers retuerned fire along the wall. A cry was heard, he looked over to his right to se 5 rovers chargeing that wall. He ran over to get him, just then an almost macene gun opened up on the sending 3 more to the ground.

It is times like these that I hate my job, legoean thought to him self. He loaded another round and took a pot shot knoking out one of the rovers wheels. He order the orderlies to take them to sister sara and the others in the baracks. He tried to rally his men to go back to protect the wall but to no use. he saw 1 rover in ruins and another retreating like wise he say 5 of his men on the ground.

Legoean Ran over to get 3 belivers from the north and placed them at th west wall. He turnned his head to see a rover clear the wall. It looked like he was heading rightinto the monelith. then 3 delta team solders fired from the archological trench and throught the wind shild knoking the driver in the chest. legoean ran over and pushed the wounded man out. he then turned it around and attacked the other 3 rovers that made it into the compund. he opened up this the weapons mounted on it, blowing the tires on the lead one sending its driver and gunner running out of it. they quickly surrenderd but the 2 others were ramming into the barracks.

Legoean over to see that his men were retreating. "Fall back North East and south wall." Legoean yelled to the top of his lungs. He ran away from his rover and into the archological trench that might give them more cover. others ran into the differn clapsable domes for cover.

"how are we doing?" asked one private.

"Not so good," I replyed.

She got up and knoked me over as a rover opened fire. she took about 3 shots in her legs knocing her unconsus.

"brother legoean we have driven them off." said a voice.

posted 01-20-99 03:07 PM ET            

Brother legoean sat at his desk in one of the clapsable domes in the outpost.

Start Communication
Casualties for belivers
-Alpha Squad
-3 minor wounds
-2 Major wounds
-1 death
-1 MIA
-Delta Squad
-1 minor wound

Enemy casuaties
-1 wounded Captured /ran away/ was shot and killed
-several reported seeing raiders die

Items distroyed
-1 clapsibal dome
-Barracks minimal damage

Captured
-1 shredder pistols
-2 rechargers
-1 rover/Badly damaged/Armored
-1 Auto Shreder? *given to Brother Rajiv for further analisis.*

End Communication

Again he looked at the casualty reports and told himself he did a good job. A little vocie inside him told him that he could stand to to kill one more person.

posted 01-20-99 09:32 PM ET            

<I'm sorry for slinging dates around so much; I'd forgotten about starting this affair>

Miyabe Minamoto was the first to realize what they had in front of them, what the hugs pile of garbage was. It was an relic of the Lessing Project.

Back around 2035, when pollution was nearing all-time highs in much of the world, a not-so-brilliant plan was concocted by aerospace engineer Frank Lessing. A transient asteriod was captured in Earth orbit. A mass driver was built into the chunk of space rock. Garbage was sent up to the mass driver, which drove it out into space in random directions. [Well, almost: Lessing did have enough sense to avoid hitting the known circum-solar objects.

The chance of one of the packets of trash had landed on Planet. The computer had already spit out the odds: less than one in one trillion trillion! But it was here now, so they might as well make use of it.

Dispatches had already been sent along the CNS network [a series of electronic devices that served as Communications relays, Navigational Beacons, and general-purpose Sensors], and the word had come back: salvage whatever possible! Silicon, aluminum, copper, silver, and gold were especially prized, but nearly anything would be useful.

posted 01-21-99 07:19 AM ET            

Donald Poe (Spartan Ambassador), Sergeant Kyuden.

"Ah, Sergeant, so good of you to join us. I don't suppose you have any idea when the vehicle will be ready do you?"

"Ambassador, I expect the vehicle to be ready for travel within the week. We shall depart immediately after our final briefing.

I trust that you are ready? You do understand the importance of our mission, don't you?"

"Yes, yes sergeant. Colonel Santiago briefed me fully on the mission and the parameters, which reminds me. I must go and look over the information I am to give to the Peacekeepers. Survival Sergeant."

posted 01-21-99 03:46 PM ET            

Sister Tammy was jet-lagged and culture shocked. It had only been 10 days since she had gotten permission to leave New Jerusalem with the Stepdaughters. There had first been the surprisingly short 20 hour ride with the paparazzi caravan to a surprise rendezvous with a number of Gaian scout teams. Sister Tammy, the Gaians, their rovers, as well as a large number of scientific samples were picked up by an unmarked Boeing 7000 VTOL transport and quickly whisked away. That had been a very long and difficult flight that must have stretched the range of the plane. Sister Tammy had been placed in a windowless cabin with five scouts who immediately fell asleep. She had no idea which direction they were flying but they but they had run into number of violent storms on the way.

When they landed it was either twilight or dawn; Sister was too confused by the length of the flight to know which. The plane had landed on a salt flat between a basaltic cliff at the base of a volcano and a ridge of tall dunes, the sound of heavy surf could be heard just beyond. Tammy looked around for the expected pressure domes but could see none. In fact, there was no indication of a settlement here at all, accept for the big plane squatting on the salt.

As Sister Tammy watched the Gaians unloaded the plane, folded its wings and attached four rovers to the undercarriage. In unison the rovers started to tow the plane toward the cliff as a section of it rolled away to reveal a large cave.

"What do you think of Gaia's Landing?" Said & Dr. Emily Birchfield-Smith. Observing Sister Tammy's astonishment she went on to explain. "Shortly after planet fall we discovered a maze of lava tubes throughout the flows that surrounds this volcano, which we call Grande Teton. We moved all of our people in as soon as we could safely pressurize a section. There are many kilometers of tubes occupied now. I know for a fact that we have the most spacious accommodations on the planet. You would be surprised at how much labor, materials and energy we saved by using the resources Chiron gave us."

"Well, Emily, that makes sense, but I don't see any roads, pipelines, greenhouses or even solar collectors. It is like you were never here." Blurted Sister Tammy.

"Tammy, we have pledged ourselves to do no harm to this planet. She has already shown us her good will and it is up to us to prove that we are truly worthy of her trust in us. And besides, there are a couple of factions with which we do not wish to come into conflict." Stated Emily.

"Who are you so afraid of?" Asked Sister Tammy.

posted 01-21-99 04:29 PM ET            

Brother Legoean looked through his transparent helmet at the 3 domes that were at the outpost. Seeing them made him think that he had finely done the right thing.

First he looked at the barracks dome witch was used in shifts by the alpha squad. Part of the dome was lost when a rover smashed into it durring the raid. so he and another solder patched it up and extended the dome with a portibal one.

The second dome was for the "citizens", AKA Geoligist and other PhD people under Sister Sara. This was used on a hourly baises for them. they sleept 8 of the 16 hours. Why would a person need that much sleep he thought?

The 3rd Dome was placed over the obelisk at to protect it once it was unearthed. This was by far the bigest dome that was at the outpost. It also held the water and rations for the people. Shipments were to be made evey half-dectrum (5 days) by the transport. of corse they had to wait for a landing pad to be cleard.

At the place where the north and west walls meet sits the Auto Shreeder that was taken from a raider rover. There was also a smaller wall surrounding the Obelisk Dome as a last ditch defence.

He also remembered about the 3 rovers that the belivers had. The first two the got was when he and his squad found a seed pod. the Third was captured fromn the recent riader attack. but this one was some what better armourd. the rovers were nicknamed Glory I,II,III.

posted 01-21-99 06:19 PM ET            

Gunfire did not bother Sister Sara. Most of her research had taken place in areas where civil wars raged, boundary disputes simmered and gangs of armed looters roamed unimpeded. She carried her own shredder pistol and knew how to use it. She was even better with a blast rifle.

Even more important, she knew how to organize and run a quick salvage excavation with and without sophisticated remote sensing equipment. That initial "remote" phase was complete on her first visit. Now she had to move some dirt. First she dug several trenches away from the obelisk to determine the natural stratigraphy. She then cleared away the dirt from around the obelisk down to bedrock. Next came the multi-wavelength imaging of the entire surface of the obelisk and surrounding bedrock. Finally she attached sensors on it surface to see if made any sounds or emitted any radiation. These sensors had been recording for about 30 hours now.

posted 01-21-99 07:25 PM ET            

"Sister Miriam, I have the data from the Hand of God Obelisk. I hope that the sacrafices of my men will not be in vane." Legoean said confedently.

Sister Miram took the Hard copy and placed it into her private datalinks terminal. "Trust me, it was well worth you solders sacrafice." replyed Miriam

"what does it say Sister Miram?" Legoean asked, "The obelisk what is it?"

"That infomation is classified to seinor officors only. You will learn about it from one of them but not by me. Ask sister Sara mabey she will tell you." Miriam again replyed

"I See, and what about the raiders?"

"Now listin to me, Do not let any non-beliver get near the obelisk. Please don't, I order you not to."

posted 01-22-99 04:27 PM ET            

It had been an intensive, and thrilling, two days in the lava tube maze that served as the Stepdaughters of Gaia's headquarters. It was like a jungle in there with plants and grow lights lining every passage and chamber. The neat single vegetable garden plots of New Jerusalem were not to be found, everything seemed to be growing everywhere at once. The tunnels themselves maintained a rich, moist, pungent odor somewhere between a rain forest and compost heap.

There were other surprises too. The food was all vegetarian. That wasn't the surprise because the Believers never saw anything accept synthburgers themselves. It was the flavors that astonished and pleased. Sister Tammy realized how bland the food of the Believers had become. There was also the inexhaustible supply of hot water. The Gaians tapped the geothermal energy of the volcanic rock for much of their energy needs. There were communal baths and shower rooms all over. While Sister Tammy was relaxing in one of the baths she observed another surprise. Many of the adult Gaians carried a distinctive blue sunburst-like mark on their bodies, usually on the shoulder near the base of the neck. The only other mark she had ever seen like that was the one that Brother Johnny had on his forearm that was caused by a mind worm sting. How could so many Gaians have survived the mind worm venom?

Most of Tammy's time had been spent with Emily in the Marine Sciences lab going over some of the research the Gaians had gathered over the last year. She was stiff and soar from the long trip and the many hours hunched over a record viewer.
"What I wouldn't do for some exercise." Said Sister Tammy as gave herself a good stretch.
"Hmmmm, you're from California, aren't you? Maybe I have just the thing. Follow me." Replied Emily.

Sister Tammy still didn't know where she was and living in the tunnels didn't help, But one night she got to activate a surface viewer and by the star fields she could tell that they were in the mid latitudes of the southern hemisphere. Tammy followed Emily to a lift tube and road the car down to an unknown depth. They got out into a broad corridor lined with canoes, kayaks, zodiacs, and other small boats. At the end of the corridor there was a pair of airlocks, a larger one for equipment and smaller one that could handle a few people. Tammy did not know what to expect as they donned and safety checked their e-suits. The chamber cycled through and the door opened into a wide, shallow grotto that gave them access to a broad black sand beach. Tammy could feel the wind on her suit as well as see and feel the surf crashing not too far away.

"Welcome to Rincon Beach, Tammy. By the way, did you surf back on earth?" Asked Emily. As they cleared the confines of the grotto Tammy could see a distant rocky point and set upon set of 3-meter high swells slant in and breaking right with precision and regularity. The waves were dotted with a surprising number of Gaian surfers looking sleek and graceful despite wearing their e-suits in the ocean.

posted 01-22-99 10:16 PM ET            

Internal Peacekeepers Governmental Memorandum #1314

To: The Office of the Commissioner
From: Katerina Brezinski, Minister of Science
CC: None
Re: Current Asset Distribution
Dated: 001/34.5

As of my last report, this was the percentage allocation of our manpower:

H2O Splitting process - 10%
Metalurgical -(focusing on improved construction materials) - 50%
Pharmacology - 20%
Ecological Research - 10%

Here is a progress report.
H2O Splitting Process [2 H20 => 2 H2 + 1 O2] - This line of research is nearing completion. The marine organism's enzyme has been isolated and we are in the final phases of prototyping the bio-machinery necessary to make use of this process. We should have a good source of H2 gas for our shuttles and fusion plant and O2 gas for our life support systems within the next three decurns. Continuance Suggested: Yes. Resource Allocation: 10%

Metalurgical, Minerological, and Materials [3M] - This line of research continuing to prove its value. We've created a number of new successful alloys and other materials; however we still have critical shortfalls in aluminum and silicon. Our search for a tenting material is still unsuccessful. Continuance Suggested: Yes. Resource Allocation: 50%

Pharamacology - This line of research is still very productive. Nearly three-hundred Earth drugs have been synthesized, and local remedies are up to fifty-one. This project may be approaching a point where further study will yeild less in results than before, but the field still is our strongest suit when it comes to negoitiations with the other factions. Contiuance Suggested: Yes. Resource Allocation: 20%

Ecology and Enviromental Studies - These studies will forever be important part of our existance on this world. We're cataloging new species at a rate of nearly twenty a day. Edible foodstuffs discovered in the course of this project now constitute nearly one-quarter of most citizens' diets. Continuance Suggested: Yes. Resource Allocation: 20%.

posted 01-23-99 10:27 AM ET            

Donald Poe, Kyuden, Santiago

"Sergeant, I hope that new base is completed on time." Her voice grating harshly from the radio caused shivers to run up and down his spine.

"Yes sir, the base will be prepared for the emmisaries. All staff have been briefed individually and we believe the ruse will work"

"It must. If we cannot win this way there will be other chance for you to prove yourself. Have I made myself clear?"

"Sir, yes sir," his voice rang out in strict military crispness. The words ending almost as soon as he had spoken them. Slowly he reached over and closed the line.

Donald looked up at him, "You lied to her."

"So, it is only the fields and the fences that will not be ready on time. Any way, if they are seen in the uncomplete condition it will only add to the ruse. How have your preparations come along?"

"Fairly well, here have a look at the forms." He handed Kyuden a slim bundle of forms,"As you can see the scout parties are going to be equipped with the new rovers. The additional armour tacked on and the second fixed gun should make them harder to beat in conflict, however the additional weight has slowed them down a bit. Also I talked to some of the people in R&D, they except that within about 7-8 weeks they will have the first prototype of the new weapon ready and will be able to begin testing and refinement."

posted 01-23-99 11:14 AM ET            

Legoean looked at the new dome that was being constucted. this was where Glory I and III were going to be keept along with any new equipment was going to be kept. The was also a Radar station in the conrner where Legoean's new Sub-Commender for the alpha squad worked, Sister Tandi Sands. Also at the other side a make shift hospital as being built in case raiders attacked again.

"Brother, I have been working on the auto shreeder to find how it can shoot so fast. My recaerch had led me to belive that a magnetic system alsos the faster rechargeing of the shreeder line of arms." Sister Tandi Reported. Still limping a bit from he leg, She continued, "I also hear that the millita is reciveing more recrutes after the incedent her. I seems that some of them are getting resless for a fight. Right now 27 have joined up."

"Great we can fill up the alhp squad ranks plus add five to each five of the ranks." Legoean looked quite happy.

"Commander, come to the radar station ASAP!" A call was given to him through his com-link.

"Sister good work" legoean said as he ran off as fast as the e-suit would allow.

once in the radar station he looked at the 12' monitor witch sereved as the radar veiwing area.

"Brother, Look here," The technitan said thi as his and pointed to several small dots. "I have found what appers to be a nomad camp. These dots move every hour and they seem to be circling the outpost."

"Raiders?" asked legoean.

"Thats what I think they are." Responded the technition.

posted 01-24-99 09:48 PM ET            

Clarrisa wandered into the Temple of Adam. Its imposing Gothic interior had the desired effect on her: she immediately felt hushed and reverent. The Temple was empty right now, as morning services had ended three hours ago and evening services wouldn't start until 15:00. She meandered down the nave past the transept and stared up into the Rose Window.

She was still troubled over the Demeter massacre and sought solace in this place of God. She collapsed into the foremost pew and broke into tears. "Why, God, why?" Although she had been orphaned at an early age [or perhaps because of this], she had always had a particularily hard time with death [even more than most people]. She sat sobbing, until Sister Ja'el came in and sat down next to her.

Clarissa regained her composure momentarily before falling back into her weeping.

"What's wrong, Sister � ?" Ja'el asked.

"Clarissa, Clarissa Anderson." She gasped between sobs. "And I'm not really a sister, I'm a Peacekeeper."

"Really? What's wrong?" Ja'el asked gently.

"Death. Death is what's wrong."

posted 01-25-99 08:30 AM ET            

Santiago, Operative #013, Donald Poe

"Ambassador, the base Last Hope is ready for operations?" Santiago drawled, for all her nonchalance it still sounded like a threat of dire retribution.

"Yes sir, the base will be ready for the envoys to visit whenever they want to?" spoke Poe, his voice on the edge of cracking from too many late, sleepless, nights,"we are prepared to leave at your order."

"Very well, in three days time you will leave. Understood?"

"Yes sir."

"Santiago out"

Her eyes slowly drifted from the desk at which she had been working out over the desolate landscape. It was so red, so inhospitable, but they would survive. They were Spartans and nothing could stop them. It was their right. They would stand supreme among all of the factions because they had struggled and overcome. The light rap of a hand on her door distracted her from her thoughts."Enter."

"Colonel, the plan is preceeding as planned."

"Yes 13. That fool Lal will accept our embassy at face value. As a sign we mean to make peace. He will of course send ambassadors and observe our badly damaged and in poor condition Last Hope base and he will hear our stories of a band of mad fanatics charging down on our base and plundering our base in the name "of the Almighty God", and he will feel sorry for us and he will help us. Then when his minister dies and the close inspection suggests the Believers we will be there to capitalise on the confusion. With luck we can expand off the peninsula and have a strong prescence on both the doorsteps of the Peacekeepers and the Believers. We need take it no further from here, we will be in a strong position and not hemmed in by the two."

"Ah politics, such an invigorating game, yes?"

posted 01-25-99 03:18 PM ET            

Legoean looked at the small timekeeper in his e-suit. 10:59 it read, one minute and their raid will begen on the raiders. The alpha Squad and Componets of delta and baker squads, along with glory I and Glory II slowly encercled the base. Hegoean looked over at sister tandi who was in comand of the "componet force" of 20 baker and delta troops.

Legoean Laid on the ground and took up a fireing position. The camp was only 100 yards away. Legoean raised his hand. 3 alpha squad members marched in carrieing a flag of truce. The camp was 2 domes surrounded by 6 rovers.
Legoean looked at the flag holder. A shreeder pistol fired sending him to the ground. The idiots legoean thought about the raiders. "Fire" he yelled out loud. He fired his carbine rifel. and other shreederopened on the camp. Raiders in the camp opened up on alpha squad troops. 5 rovers suddenly came to life and roared through the hole it's troops made.
Then the camp was motonless. "hold your fire", legoean commanded. he waved for 3 troops to head in to the base. the three catusly walked to on of the domes.

posted 01-26-99 01:51 PM ET            

When the drawling day,
Comes to a close.

It is not the strong,
Who triumph;
But the ones who,
Are belivers of god.

They shall live to see,
The next of the many days;
Of tomorrow...

And of the days,
that will bring forth;
A world that is new,
For the children of god.

The world will be full,
Of the deamons that have
Been sent to claim it
As their own.

Brother Shashami died,
So that the next generation;
Will live in the lord's promised land, Tommorow

posted 01-26-99 09:12 PM ET            

From: Jesse bed Obed, Minister of Exploration
To: The Office of the Commissioner
CC: none
RE: Lessing Project Salvage Operations

As per your instructions, a small camp with seventeen personnel has been set up near the Lessing Project deposit. Salvaging of materials has begun and the Intrepid, the shuttle with the most cargo capacity is making a run per day out to Mount Trashmore, as the outpost is jokingly called.

Mount Trashmore currrently is storing several tonnes of possibly salvagable electronics as well as stocks of palladium, titanium, cobalt, gold, silver, platinum, industrial diamond, ceramic composites, aluminum, and other materials. This find is going to be extraordinarily valuable to us and will provide us with a short-lived supply of a number of rare materials.

Hope's salvage yard is going to have to be expanded and improved in order to handle the influx of materials. Currently, less than five percent of materials salvaged are likely to be fully recoverable. Please consult with Minister Vanerian about this.

posted 01-26-99 09:13 PM ET            

"And now, without further ado, I christen this vessel the P.K.S. Nicosia." Lal intoned.

Crack. Splash. The contents of a now-broken half-liter bottle of Believer synthpagne [synthetic champagne -- Hans Dunant, the consulate's commercial attache and deputy-chief-of-mission had brokered small trade: ten half-liter bottles of sythpagne for twenty liters of honey], glistened in the midday suns on the prow of the dhow.

Applause broke out among the assembled crowd. The Nicosia was the pride of the small Peacekeeper Navy, run by a subsidiary of the Black Watch militia known as the Blue Watch, and many of the upper echelon had come to see her maiden departure. [Lal's decision to take short vacation on her had contributed to this decision for many of them.]

Now that the ceremony had ended, the crowd slowly drifted off, knotting into small groups and chatting over the comms. The rite of commencement had finished, and now all but a very few among the crowd were to be left out of this vessel's immediate future.

posted 01-28-99 08:43 PM ET            

"Good evening, Amin," Jeremy called out to his landlord.

"Good evening, Minister. How does the day find you?"

"Quite well, sir. And you?"

"Very fine, indeed."

Borodino pulled out his key, unlocked the door to his apartment, and entered. He placed his briefcase [paperwork had followed them even to Chiron] on his desk. After quickly grabbing a Coke from the microfridge [God bless the Believers!], he sat down in his overstuffed easy chair and picked up the notebook on the table to his right.

He opened to the first page and started to review his notes. He, Kildare, Eck, Roberts, and Anderson had been working on a formal consitution for a while now, in order to replace the nearly ad hoc manner of government that they currently lived under. [It was amazing that fifteen councilors, twenty-one ministers, five justices, a consulate staff, and seven mayors -- among others -- could run an ad hoc government, but such was life on Chiron.]

How many years now had it been since his last Consitutional Convention? The Detroit Conference had been back in � 2030, August 2 to be exact. The end of the Quebec War -- really a very complicated mixture of a Canadian civil war, an American civil war, and Quebec-US war -- and the beginning of the North American Federation. Amendements thirty through thirty-six, the Federation amendments, and he had been there; a representive of Maine. Ah well, back to work.

---------------------------------------------

Preamble to the Constitution of the Faction of Peacekeepers

We the people of the Faction of Peacekeepers,

In recognition of the precarious nature of humanity's survival on this new world,
In awareness of the limitations on freedom and human rights among several of the other factions,
Being Mindful of the many mistakes of Earth,

In order to establish justice; to reaffirm faith in fundemental human rights, the dignity of the human person, and the equal rights of man and woman; to safeguard our liberty and that of succedding generations; to promote the general welfare and the common defense;

Do hereby ordain this Constitution of the Faction of Peacekeepers.

---------------------------------------------

posted 01-29-99 04:42 PM ET            

It had become Brother Greg and Sister Cecilia's custom to meet at a pub after their biweekly briefing meetings with Sister Miriam and the Ecumenical Council. Over a couple of pints of fairly good ale and a plate of really tasty fried calamari they would try to predict the next edicts from the Lord's Believers leaders. St. Bernard's was generally pretty quite this time of day. The only other customers were an odd couple of an Asian Believer militiaman drinking and laughing with woman, a Russian judging by the half empty bottle of Uncle Joe's vodka in front of her, obviously form the Peacekeeper consulate.

"Pass the cocktail sauce Sister. Thanks. Now what was that council meeting all about? I would have thought that the councilors would be unanimous in their support of researching the obelisk." Muttered Brother Greg between bites of seafood and sips of beer.

"Ah, Brother Greg, you haven't spent much time with true fundamentalists, I see. To them everything is a direct sign from god or temptation from the devil. Everything must be evaluated within those perimeters. Can you honestly say if this will turn out to help in our survival or advance our understanding our place in god's plan? Or will this turn out to be one more source of corrupting power, envy, jealousy and evil? Stop hogging that platter and pass it over here." Remarked Sister Cecilia. "You're getting the next round."

"One thing is for sure, Cec, that object has already caused us more death and injury than anything since that hurricane killed those kids out by the guncotton tree forest. Brothers Rahjiv and Legoean have done their duty in protecting our rights, but I wonder at the cost. Same, again?"

"Yeah, Brother Greg, one more St. Peter's Pale Ale, and then I gotta go. Well, I hope Sister Sara can enlighten us all about that 'gift from god/work of the devil' when she reports in. The obelisk doesn't scare me so much as the idea that whoever, or whatever, made it might still be around here and not at all happy we showed up uninvited." Sighed Sister Cecilia, "Get another platter of calamari while you're up too, and tell them not to overcook them this time."

posted 01-29-99 09:17 PM ET            

The decision to reinhabit Demeter's Plantation had been a difficult one, both psychologically and logistically. The ghosts of the forty-two slain still seemed to inhabit the dome, and a replacement fifty-some-odd were difficult to scrape together, given the over-spread nature of the PK population. Demeter's Plantation, though, sat astride an important isthmus, and it was strategically necessary that an inhabited outpost exist, well, just about where Demeter's Plantation was.

It had taken the full three decurns to clean out the dome -- and its outside was still tainted. Two tonnes of xenofungus had been destroyed. Two hundred and fifty seven starcrawlers had been discovered and sent to the xenobiology lab in hope. All eight fisher misties were released into the wild. An undetermined number of AC shrews had been fumigated.

But now Demeter was repaired and cleansed and was again inhabited, Mayor Chen in administration. Crops were being grown. Air and water were cycling through the LS systems. All was as it was before.

posted 01-31-99 02:09 AM ET         

It shone like the light of truth itself upon the otherwise dark computer screen.

AGGCTTACGTACCGTACCGTAC

For millenia, humanity had been seeking the secret of life itself. Here it was, in all its glory.

GTCATAACTGGTACGTAATCGT

The Code. For years, the greatest of Gaian biologists and scientists had been working to crack it. The stakes: humanity itself.

CGTAACGTTATTCGATAACGTTGG

The genome. The secret to our souls. This would put the Gaians on the map.

CTAGGTACTGATCGATCGTACGTA

TO: LADY DEIRDRE SKYE
FROM: DR. P. SELAMUS, DIRECTOR OF GENETICS

THE MAPPING OF THE GENOME IS NEARLY COMPLETE. WITHIN MONTHS, WE SHOULD BE FINISHED, ENSURING A CONTRIBUTION BY OUR CIVILIZATION LASTING THROUGH ALL TIME.

posted 01-31-99 01:28 PM ET            

Legoean spashed the last bit of paint on his e-suit. He steped back to admire the job he did. The suit looked like it would blend into the planits senery perfectly. Plus he thought about how much thi swould rase moral in the alpha squadren.

Most of the suit was shades of brown to dark green. He got the paint from a small store in New Jerusalam. There were shifts for who went back to New Jerusalam. For every 8 days you got 2 days in New Jerusalam. You could save your days to make a long vacation.

He also loked out the the first perminant stucture in the outpost. The barracks were large enuff to house the 30 members of the alpha squadren.

Also a landing pad was build for the heavy transport when it brought suppies. next to the landing pad was a shed where the land rovers were kept. The alpha squad also put "Tank Traps" out on the font of the wall to stop the raiders rovers.

posted 02-01-99 03:19 PM ET            

Sister Sara got up and brushed the Chiron soil from her overalls. The crustal imaging probes had been detonated a couple of weeks ago so the placement of these delicate monitors had had to wait until the obelisk had been clear of those tremors. She now just finished downloading the data from the various monitors that had been attached all over its surface of the alien obelisk.

"Hmmmmm, no change, that's interesting." Murmured Sara to herself as she gazed intently into her tri-corder, hoping fathom its secrets. Then turning to her commlink.
"Brother Legoean, I think I am about finished here. Have you finished your analysis of radio fields yet? I am ready to return to New Jerusalem and give my report to Sister Miriam and the committee."
"Here, Sister Sara, I've checked and double checked all of the sets and all of the results. I don't understand why, but I'll take any advantage I can out here. We will be ready if those raiders ever come back. I'll have the helicopter warm up for your return trip." Replied Brother Legoean.

001/34.3
Believer Council Chamber
New Jerusalem

Sister Sara looked up from her notes to the leading officials of the Lord's Believers. She saw many emotions on those faces, curiosity, ambition, hope, wonder, a little fear and, yes, hate.

"In summary, Sisters and Brothers, the obelisk is made of an artificial gem-like mineral that we like to call NIMmite. NIMmite is essentially indestructible and a perfect data processing/energy transmission matrix. The obelisk was install over a thousand years ago and was intentionally buried by its creators but partially uncovered by erosion. We have not been able to decipher any of the markings on its surface so far, if, indeed they are decipherable. The crustal imaging probes demonstrate that the obelisk is just the tip of cable - probe - pipe, whatever, that penetrates the planet's surface to a depth of at least 5 kilometers. That's as deep as our instruments can trace it. The obelisk does not radiate a thing. It just seems to sit there and absorb ambient conditions across the entire spectrum.

posted 02-01-99 07:39 PM ET            

Light filtered through the trees, cutting road swaths of sun across the forest floor. Alexander Mason piloted his small rover along the dirt lane the threaded the heavy woods.

The primary species around here was Guncotton, a tall tree with hard steel-colored wood, broad sharp leaves, and cotton-looking flowers. All in all, a fairly unattractive plant. Several species of Earth maple, oak, and pine had been introduced, though, and were doing moderately well.

The road meandered to rim a deep ravine through which the Falcon River flowed, some three hundred meters below the rim. The water churned white down the rapids of the river.

Fifteen minutes later, Mason pulled into sight of the settlement of Falconbridge. It was undomed, each building being airlocked. The town's namesake, a forty-meter-long granite arched bridge, spanned the chasm. Twin stone falcons guarded both approaches.

posted 02-02-99 04:53 PM ET            

Harris Logan, late THX1139 of the Human Hive, stumbled over the rocky crags. He wasn't going nearly as fast as he liked. Back on Earth, he'd been a long-distance runner, but the bulk of his envirosuit added to the lead weights which Planet's gravity had so graciously attached to his feet slowed him to a relative crawl. He had to rest, he'd been fleeing for almost two decurns now. Barely thinking about it, just doing it, he found a rock outcropping and took shelter under it.

A year... it'd been over a year since the incredible escape from the Unity. Logan remembered it well, he'd seen it many times replayed in his mind's eye. A frantic dash for one of the escape pods, any escape pods... full... full... full...

He'd eventually found a pod with room, and breathed a sigh of relief. But that relief was short-lived, for the pod Logan had stumbled into was the pod controlled by Sheng-Ji Yang.

The full bearing of what Yang was trying to do on this new world hadn't sunk into Logan at first. He was too busy adapting to survival on Planet, and shut out most everything else. The Hive hadn't been that bad at first, but barely three decurns after Planetfall, Yang's bizarre social experiments had begun. It had been hellish, though he was to be one of the last to be treated to it. Mind-altering drugs, long brainwashing sessions, the infernal, hideous Groupthink... all of what was worst in humanity brought to the surface and magnified a thousandfold. As someone once wrote, only the few cubic centimeters inside his skull had been his own.

Those memories of the Hive were still dirty to Logan. He had tried to repress them, block them out, but whenever he closed his eyes, he saw the somewhat-grand concourses of The Hive, saw people he knew, people he had counted as friends, transformed into mild-mannered, subservient sheep, utterly incapable of independent thought, all bowing before the incontestible might of the State and of the omnipresent Them. The ultimate form of communism. The last government ever required, Yang had said in one of his daily telecasts to the drones. It was too bad he persisted in treating humans like insects. Even a monster like Stalin couldn't have approved with what Yang was doing.

Logan managed a weak smile as he recalled one of the rare bits of graffiti that graced The Hive's otherwise immaculate corridors. It had read, "Welcome to Oceania." He'd been told it was from an old Earth book, called "1984." Logan had never read it, but if what he had been told about it was true, Yang must have held it in higher esteem than Mao's Little Red Book.

All in all, Logan considered himself extremely lucky to have escaped the Hive's minions. He'd been part of a frontier patrol, a group of thirty or so soldiers who scouted out territory, skirmished with mindworm boils, and the like. Logan had treated it as both a celebration of freedom and a death march, for his distance from the ever-present State Police would be short-lived, and he knew that he was due to be "processed" as soon as he returned.

"Processed." One of the most haunting words ever used in the Hive.

His small group had run up against an equally small boil of mindworms. It had been the first time outside of propaganda televids that he had seen these nightmare creatures, these avengers from Hell bent on eradicating the small group of humanity which had managed to avoid its Armageddon, its doomsday. No bigger than an old ballpoint pen, these horrors had already killed hundreds of colonists Planetwide.

Despite its size, that mindworm boil had to have been one of the most skilled ever encountered by the colonists. Termed a "Demon" boil by military analysts, the worms had almost overrun every single defensive line the patrol had set up. In the end, the humans were victorious, but at a very high cost; Logan had been the only survivor, human or mindworm. Possibly the worst thing he'd had to do was to dispose of the corpses, lest more mindworms breed within them. Even with his envirosuit, Logan swore he could smell the acrid stench of burning flesh. Illusion or not, it was a smell he'd never forget.

So, with nothing more than a heavily-used flamegun and a single planetcompass, Logan had made a break for it. It was what any other rational person would have done in his position, risk a quick immolation in the highlands of Chiron rather than spend a virtual eternity in Yang's totalitarian hell.
Logan knew that he had to keep moving, because the Hive might be looking for him, as someone would have had to burn the bodies. If he could stay in relative hiding for a while, though, he had a chance of going undetected. If not, he had his flamegun. "Only a couple more decurns, then we'll be home free," Logan muttered, going on his way once more. As he walked, a few slogans he'd learned were from "1984" flashed through his mind, with stunning similarity and applicability to the Human Hive.

War is Peace.

Ignorance is Strength.

Freedom is Slavery.

posted 02-02-99 07:28 PM ET            

001/35.1
05:01:34

Chen emerges from his quarters and walk along the long dark corridor of the base. Getting up early has always been a habit of his ever since the training days in the Yang Family training yards, and continued with him through the years in the 27th army and now at Chiron. He pondered the events since Planetfall, and even as far as back as That Day. The events in that day is firmly entrenched in his mind, on that day his fiancee Li died in a Spartan suspected bombing. She was so young and innocent, and why would the Spartans bomb a hospital was beyond him. No matter now, it was God-sent that a Spartan faction has establish on Chiron, this must be his chance to get blood for blood! Pushing away those thoughts to the corners of his mind, Chen arrives at the mess hall. He ordered a cup of Xenofugus tea, courtesy of the Morganite delegation that arrived at the Economic advisor office. Real Earth tea is hard to come by these days, needless to say, not much of it was left after P.F. Now those crafty Morganites has come up this subsitute. Rations are low as well these day, but that doesn't bother Chen nearly as much, His trainings in Tai-Chi allows him to go more than a few days without food. Chen looked at the redish liquid and then took a sip from the cup, not bad, not nearly as good as the Long Jing tea from Xi Hu though. It'll do for now, it has to. Chen had aquired the habit of tea drinking ever since age 8 when he was appointed to make Tea for Gandfather, then head of the Family. He still remembers the looks on his father's face when he refused to take over as head of the family.

A tall figure entered, it is Ren, the Chen's best friend since age 10, and sworn blood brother.

Ren stopped to get a cup of coffee before he arrives at Chen's spot and sat.
"Yo, Chen, you're up early, as usuall." Ren remarked, though he's up pretty early as well.
"Still drinking that muddy color western beverage?" Chen said with mild distaste.
"Hey, it does help clearing my head," Ren countered.
"Where were you last night?" Asked Chen, though he had an idea about the answer, Ensign Alisa Well's quarters. Ren has been quite a ladies man ever since high school, at one point Chen was envious at that trait. Until Li that is...it pained him to think of her.

As if reading Chen's thoughts Ren admitted "Well, I was only at Alisa's quarters for the later half of the night, we didn't even get a chance to go too far..."
"What kept you up?" Chen questioned with mild concern, Ren may treat everything else lightly, but he certainlly is a efficient worker. It must've been something difficult.
"The Econ advisor assigned me to deal with the damn capitalist Morganite neigotiator on trade plans, needless to say, that guy was quite a pain in the you know were," replied Ren, "and by the way have you about what happend?"
"What?" Chen replied with disinterest
"A guy involved in the experiments of Chairman Yang escaped," Ren explained, "They believe he is heading toward Spartan territory."
The word Spartan caught Chen's attention.
Ren continued: "The council of advisors is trying assemble a team to track this guy
down before he spill any thing to the Spartans, I believe his name is Logan...."
Chen did not hear the rest of Ren's words

Maybe this is his Chance......

posted 02-02-99 08:22 PM ET            

Tony Albanese suited up and exited into the rover-bay. He entered rover #1, closed the hatch, and opened the airlock. Chiron's nitrogen heavy air meant instant nitrogen narcosis for those unprotected from its ravages. He started the rover's engine and headed north from Mintaka Point through the tunnel.

The Point, as it was often called, was named for its unique geographical position. It lay within a large centaurite column on the southern shore of the Columbus Isthmus between the Sea of Poseidon and Orion Channel, which connects the Central Sea, Michigan Bay and the Oceanus Australias. Mintaka came from the fact that Mintaka, the westernmost of the stars of Orion's Belt, stood at the Point's zenith when the settlement was founded. An arch about fifty meters long connected the column with the mainland, and it was through this arch the tunnel lay through which Albanese was now driving.

Albanese continued north, eventually coming out of the tunnel about two clicks north of the roverbay. His mind wandered back over the last year and a half: The flurry of work at the initial settling of Hope, when he had been chief of the general engineering corps. Actually, he still was; and as such was in charge of construction. But he had always been a worker; he liked to get his hands dirty. So most of his original duties had been absorbed by the Ministry of Industry, and good riddance! Poor Levon, slaving away, mostly at a desk, balancing reports, haggling with the Board of Councilors, kept from real work. But Tony had gotten away, out into the open world; free to build! And he had! Raising the dome at Avalon; designing Poseidon's shipyards; overseeing the construction of Cassandra's Bridge in Maxell's Plain; digging the mines of Vulcan's Forge; architecting Falconbridge's namesake; installing Viracocha's physical plant; surveying the land for Demeter [Oh poor Demeter!]; and now, constructing Mintaka. He was the only person yet to have visited all of the Peacekeeper settlements. Not only that, but he had built them all! Well, had helped. He grinned.

Always busy! Ever his motto. And now that Mintaka was mostly built, he had another matter to attend to. Back when the orbital scans were conducted, a strange feature was noticed connecting the Sea of Poseidon and the Orion Channel. It had looked a lot like a natural channel, except for its unusually glossy sides and strangely regular steps down. While the Narmonov Expedition was heading towards New Jerusalem, the Lewis Expedition had started out by circumnavigating the Sea of Poseidon. One of their chief objectives was to investigate the Grand Canal, as it was being called.

posted 02-02-99 10:49 PM ET            

We looked out the small viewport one last time, the last view of a universe we may never see again. Then the alarms. The red warning lights lit up on the sides of the pod, and the main lights shut off. The huge room was cast into an alert state. There was no noise. The room was about the size of a caffiteria, and carried several hundred people. All of them thinking the same thoughts, worring the same worries. Alpha Centauri A still shone through the window high above us, giving us light, but no warmth. Then the inevitable happened. The ablative armor closed over the window, it's irus doors closing. A narrow beam of light still shone through it, then was cut off. The red lights gave way to two amber strips of LECs in the wall, two solid strips of light in a dark world. They cast an errie shadow off of everything, including faces. Jessie grabbed my arm, holding me. I put my hand in her's, awaiting our future. It was so much like four years ago. Well, really more than eighty years ago, but suspended animation kept it at four of our years. Four years ago, when our daughter was born. I held Jessie's hand as she went through labor, and I could feel the fear in her body. Now I could feel the fear in her and Jamie, who had just latched onto my free hand. The amber lights blinked, then came back on. Most of the energy was now being diverted to the computers and engines. The row of LEDs came on in the center of the room. One minute to aerobreaking. This was the most critical phase. The pod would enter the upper atmosphere of Chrion, slamming into the air at an incredibly fast speed, and burning for about a minute before slowing down to orbital velocity.

Thirty seconds. The room was silenced. Fifteen. Ten. I held my breath. If we came in too steep, we would burn up. Too shallow, we would skip off like a pebble one water. 5... 4... 3... 2... 1...

posted 02-03-99 04:16 PM ET            

The Lambs of God was always a very busy place. The rooms had originally been storage containers for water/sewage/irrigation/recycling systems. Now the attached containers were full of cribs, changing tables, nursing chairs, wash basins and diaper cabinets (clean/dirty). This was Madame Sonjia's domain. She had taken charge of the first confirmed pregnancy on Chiron and coordinated the prenatal care, births and nursery care for everyone ever since. Madame Sonjia was one of the few in New Jerusalem that was not surprised that the first baby was born exactly nine earth months after planet fall. Because of the rigors of the cryocells, no women were allowed to start the voyage to Alpha Centauri pregnant. Where had those couples found the time or privacy in those last awful days on Unity or the horrible conditions on Planet? Sonjia knew that there would always be time for love and children.

Among the Believers there were no housewives or househusbands. The colony needed all of the adult's' skills during the working hours of day and night to insure survival for all. The Lambs of God was a communal nursery where parents could leave the newborns while they worked their shifts or put in their time with the militia. Most Believers also volunteered their time to share the care of these first Centaurians. Madame Sonjia was running out of crib space fast as Believer couples seemed to want to make up for their last childless years on earth.

Madame Sonjia was continuing her research in to A.C. astrology. She had already calibrated her known earth horoscope with one she had calculated using Chiron as datum. She was now ready for the next steps. Within her data files were exact times and places of every Believer birth on Chiron and as well as preliminary horoscopes for each. Now, studying a global map of Chiron intently Madame Sonjia was overheard by nearby caregivers as she talked to herself, a common occurrence.